Detailed information on ENST00000450627

lncRNA-RNA interactions

Number of interactions: 3

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000544440 MYC binding protein 2, E3 ubiquitin protein ligase protein coding ENST00000450627 606 232 CDS Cis
TCONS_00067015 MYC binding protein 2, E3 ubiquitin protein ligase novel protein coding ENST00000450627 606 232 UTR3 Cis
TCONS_00067018 MYC binding protein 2, E3 ubiquitin protein ligase novel protein coding ENST00000450627 606 232 CDS Cis

Sequence

>TCONS_00067018 (348 nt)
TCAGATCTAACTCCAGTCCAATATCCCCTAAGAAGCCTTCTCTGACCACTCCAGGGCACAATGATCTCAAGGTTCAGCATCTCCAGAGATGAGCTTTCCA
AATACCTGATGAAGATATGCATGAGTCAGTGATGCCACAAAATGCCACAGAATATCATGGAGAGAAGTGGTTTGGATGACATTACACAGAAGCCAGTTGA
AAGCCTGAAGAAATGACGGTTAAATGAGTTCAAGAATAAAATACATGAGTTTAAAAAGTACTCAGAAATAAAGTACCTCCATGGATTAAGACTTCAAAGA
AAGATACTAGAAAATCTTTTTTAATTAAAAAAAATGCCTTATAGTTTTA

Expression



Full and truncated open reading frames discovered in TCONS_00067018

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.