miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse :: Contigs




EST name EST sequence
gi|113951940|gb|EE683469.1|EE683469 ATCAATTATCGTTCTTAATAAGGGTTCTTGGCTTTTGAAGGTTGTGCTTGTTTCTTCTTCTTCTTCCACCATAACCCGAC
ACAAAGCGGGTTTGGTTCTGCTTCTGGTTTGTGTCGGGTTATGGTGGAAGAGTGGAAGATATTGGTCTTCTGGTGAAGTT
GATCAATTATCGTTCTTAATAAGGGTTCTTGGCTTTTGAAGGTTGTGCTTGTTTCTTCTTCTTCTTCATTTTTCTTGAAA
ACTTAAATTAGTTTTTGATTATAGTTCTCCTCTTGATTTTATTTTTGTGTGTTTCGGTTCAACGTTGTACTCTTTAAACA
ACTCATACATCAAACGTGAAAAACGGGAAACCCTTTCCCGTGACCAAGTCCCGAGAGAAAAAAAACCTCTGATGTGTTTG
TCTGAAGAGATCACTGTGATCTTCTTGCCCTCTGGCCCCCCCTTCTTCCAAAAAAATCCCCCCCCCCCCACCACAAAAAA
GGAATTCTTGATTACCCCGCCTGGTCCCGGGACGATCCAAACGAAGATTCAAGCTCCCCCCTCTAAAACGCCGGTCAAAA
AAAAAAAAAAAAAA