miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse :: Contigs




EST name EST sequence
gi|11602225|gb|AL450817.1|AL450817 ACTTATTCTCCCTGTTGCTCTGCTGCATGCTGTTGCATTCGCTCTTGGCTATTGGATGTCGAAATGGTCTTCTTTTGGGG
AATCAACTTCTAGAACCATCTCAATTGAGTGTGGAATGCAGGTACACAGATATTTAAATGCTCAGATTTAATAACATTAT
GGTTCTTATATTATTGACCTGGATATTAGGAAGGTAAATTTAGTGAACGTATCTACTTAATGCAGTCTCTCGTGCACTAC
CTATTTAGATTCAGTTCTTCGTGTAGTTGTTGCTGAAATATTGACGTCTAAATGTGCAAATATGTTATATCTTTCTAATG
GTGGTGGACACTGGACGCCAAAAGGCCCAAGGGTAAGGATAAAATGTACTACCTCGGTCTGGAATTACTTGTTGGAGAAA
TAGATGTATCCAAGATGTATTTTAAGTTCCAAGATTCATCCATTTTTAACCATTTCTGCGACAAGTAATTCCGGACNGAA
GGGTGTATCCAAGTTTACGTTAACAACACCGTGCTAAATTTGAAC