miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse :: Contigs




EST name EST sequence
gi|117469026|gb|EG801245.1|EG801245 CATCTTTAATTCTTTATTTTTGAAACACAACATAAAAATGTACGTAACAGAAACATCTATAAAAAAAAGTCATCCATAGT
GGTACAAAAAGTAGATGAATTTGACGTGATTCAGACACACAAGCAGCAGCAGTAGGCTACAGTAGTACAGTAGTAGCAGT
GGACACTCTGTCTGTCAATCCCGCTGTGGATGTCTGCTGACTGAGTTCACGACGCAGTAGCTGGTTGAAGGGGACCAAAC
CTCACTAAAACACCTGACTTGGTTCCGTTTGACCAGCCACAGCAAGGCGTGCAGTTCAGGACGAGAGGGAAAGCGAGAGG
GGGGGAGAAT