miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse :: Contigs




EST name EST sequence
gi|169541086|gb|FE558723.1|FE558723 CACTTTGACTCTGCCTTTATGGAGCCATTTTCCTGGAGTAACATACAACAAACAGCCACAACGAGACGTCATCAAAGTCC
TGCCACCAACAACGTTTTAACGACACGGAAATAATAAATAAAAAACCTTCACCATCTCTGCATGTAGAAACATAGAAATC
TCTTAAGTCTAGCATCATCCTGATAAAACTCAATTTTCAGTGTGACTTCTCCATTGGGAGTCACAACAACATGCCAACCG
CAACACAATCAACAATTAACATCTGGGTGGGGAGAAACAGGAGATACATGATCTGCCGGGGAAAGAAAAGGAAATAAAGA
TAGGGTAGAACGTAGAAAGAACATTGCAGGTACCGGTAAAACAATGGTGAAACAATATTGGTAGGCCACAAAACATGGTA
AAGTCTCTGTCACACACTCTAGCCTGGGTACCATCCTCCATAGTAAGCTCAGCTGGCTCAATCTTTTCATAAATAGCAAC
CGAAAAGATTGAGCCAGCAATTGCTAAAGAGGATGTTAACGGTCTACGGTGACCATGTGTCTACTATGACCATTTACCTT
CATAGATTTGACTGTAGGTTCCATAGGTATAATGCCAACCATCATCATTCTGTGGGTACCTTAAAACCGCCACCTCAAAA
ACCAGGGTTATCGAGGCCTTGTCATTGCACGTCTTTAACACCTGGATGTCTGAAGTGTGCATATGTCAGGGATCACCAAC
GCTGCATT