miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse :: Contigs




EST name EST sequence
gi|177781561|gb|FF334324.1|FF334324 CAGAATAGTCAATCGCATCTGTCAAGACAGGAGAAGTCGACGACGACCACAGCGCGACGAAGATCTTAATATGGACTTGT
TGAGACGACTTCGGCGACGACCAAATAGACTTGAGACGACTTCGGTGACGACCTGCAAGACTTGAGACGACTAGAGACGG
CGGTATTCATATTATTATAGCATCGCGACCAGGTGAAGTGGTGACGGCCATTACCTATATCATAATGTGTACACGCGTAA
TGCGTGTCACGAGACTCACGGATTTACGTCTGGAGAATTCGAATCAACGGATTATGGCCTCAATGTACACACACGGACAG
ACGTGGCGTACTGCATAATATATTATATTATTCCAACGCAATATAATATAACCGTATAATGGCGTGTGGCTGCAACGCTG
CAGCGCGGAGGTGAAGAGGAAATGAAAAACAATAATAAAGATGTGCCGGAGATCCAAGTACAAGCTGTTGTCGGTCCGTC
CGTCCTCGTCCGAGCACCGATGCAGAGCTGCAAATGTCGACGAATAATGCGTGGCACCCTGTACGTATACTAAATGTATC
CTGAGTGCATTATAAAACTGTCCGGTATACCTTCAGTATACGTAACAGGGTGCCATACCGATCTTCCGGAAGTGGTCCCG
TGGCGCGGCCTGCAGCGTCCCTGCGACGACGTCCTTTTCGCGTACAATTTTTAATATTATAATAAATACATTTGGTATAA
CATACATATTTATCCGTCGTTCATTGGGTCGGGGCGTTTACCGCGAAA