miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse :: Contigs




EST name EST sequence
gi|195268949|gb|FG416611.1|FG416611 CGGTTCTCCATTTTTAAACCCAGAACCAAAATGATCGTCCAAAGGAATCGAACCGAACCTACCCGAGTGAGATTGATTCG
GTTCTTCAATTCTTTTTTAAAATAAGCCACCATGAGTAATAATAGTATATGATGAGTGCACTGTATTACTATATGATCGA
GTCTAAACTTTGGTTCCTTATTCGGTTCGGTTTGATTCTGGGTAAAAATTCTTATAGACCCGAGAACCGAACCGAACCGA
ACCGGACGGGTCTACAATTTTCAGAATCGAATCATGAGCGTGATAGAACC