miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse :: Contigs




EST name EST sequence
gi|211945046|gb|GE623062.1|GE623062 AGGTACTGTATTATACTGTATGTTCATGTCTCTAGTTTGTTCCAGCTGGGTTGCCGACACTCCAGTCCTTGACCCAGTGA
ACACCTAATGCTTTGCTAAAGCTGGTAAAAAGGAACCAAATCACCTCTTGAATGGATTTGGTCCCCTTCAACCAGCTGTA
GCTATGCTTTGATGACTACATACCGTCCTACCGGAGCTCCTCTCTCTTCAATGTTCTGACTGACTGGATGATAGCGTCAA
TGATCAGGTGTAGCCAGATGCCTCGACTTAGTGAAGATGAGAGCCGACGTGTCTAAGTGATTATTGATCAAGTATCATGT
TTCATTGCTGAGTCTGTCTGCCTTTCTTCCATCTTGACTAATAAAAAAGAAGCCATCAGAGACTG