miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse :: Contigs




EST name EST sequence
gi|2250243|gb|AA512389.1|AA512389 ATTCGTCGACATGCAAGAAAGAATTTATTCTTAAAATCTTCCTCAACATAATGTTACTTGGAATTGATGACATTATTTAC
ATTTAGAAAAAAAATGAAAATGTAATGTTAGAAAATGAGTTTGGGGGGGCTGGAGAGATGGCTCAGCAGTTAAGTGCTAG
TTGCTCTCACAGAAGGCCTGGGTTTTCTTTCCAGCACCCAAATGGTGTTGCACAACTACCTGTAACTTCAGTTTCAGGGG
GATCTGATGCCTTCTGACTCCTGCCTGCAGCTCGCTGTTGTGTGCATACTTAACACTCAGGCACACA