miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse :: Contigs




EST name EST sequence
gi|30057231|gb|CB862672.1|CB862672 ACAAAATAAAACGATGAAATGTCCCATGAGATGAAAGAACGAGACTTCCAAGTTCCAACATTTCTTTGTTACTCCCTCCG
TCCCAAAATAAGTGTCTCAACTTTGTATTAGCTCTAGTATAAAATTGTATTAAGCTTGAGACACTTATTTTGGGACGGAG
GGAGTACTATTTATCCTCGAGATACATATCCAATTTCACCAGCACCTCNAGATCCAACTTATTATTGGNACAATATACTA
GNAGAAGGACATGTCNATGCATAGCTCACTANAGAAAACAGTGCTCACAGCGGCCAGTGTACACATGAATACATGATACA
TAGACCATACNCAATCATGGAATCAGCAGTATCTTGCCAATGTGGGAGCTCGTCTCCATCAGCTTGTGAGATTCAGCTGC
TTCGGACAGAGGGAATGTCTTGTAAATCACCGGCTTCACCTTGCCCGACACGACGGCAGGCCACACGTTCTTCTCCACCT
CACTGANGAANCTGGGGCTTTGTTANCGAGGGGTTCTGGTTCCGCAGTCCAAGCAACCTTGGNATGGTCAAGCTTTCGGG
GCAAAGCAT