miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse :: Contigs




EST name EST sequence
gi|40910658|gb|CK526203.1|CK526203 ATTCCGGGCAAAAGAAAATAACGTGATTGCATCTTGTAGTCGGCGCGTCGAGAACATCTGGGTCTAGTGACTTAGAATTA
TTTTCTGTACCACGATGTACAAGCCAGAAAGGAATAGTTTCAACGTAACCATACAATAAACAGTGAGCTTAGTGAAAGTT
TTTTAACGTTCTCGATAACGTAAAAGTTAACTCAAATTTGTATGGAGTGGGAACGTTTGCCGCTAGGGGCGCTGTTCCAA
CTGCATACAAATTGGAGTTATGGCTATTTATGGCACCATTTCGATAAAGCGGCACAACACGAGAACCCTCTCATCGTTTC
CACCTACCACCGGGTCGCGTTACCGATCCGGTGTAAGATTCTGCGAAGATCCGGTGGTCGGTTCGTGTAAGCAACATCGT
CAGGTTAGAGCCCCGTGAGTTCACCTACTAATTCGGGGAATCTAAAATAAAC