miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse :: Contigs




EST name EST sequence
gi|58732585|gb|CX943706.1|CX943706 TTTTTTTTTTTTTCGAGACAACACCAAAATACACAGGAATGAACGAAAACGAAAATTTCCAAATTCGAAAAAGAGAAGGA
GGAACAACCCGAAGGATTAAAACAAACTCGACCCATCATATATAGGTTGGATCGAAAAATTCTAGAATTTGCTTAGAAAC
CATCTGGCCTGGAAGCAAAGACCATGATACATTGAACTAGAGGAACGAGGTCAAATGCGATGATACGGATCCATGCTTGG
GGGTACTCCTTCTCCGCATTCAGGAAGCTCCTTGACAAGTGGGGCTGAGTCGGAGCAACCGAACATAGGCAGGTCCCACA
TTGTGCAGGATCTTCCAGGATAGGACTCGGGGGATCTGGCGTTCTCACGGTAGACAAAACCGTGCTCAAACTCGAATGTC
CAAACAAGGAACCCATTTTTTGCGGAGCAAGTAGCAGAGTTCCTTAGCCAACTGAGTTTTAGTTAGGGGCGCGAAGCATG
AGAGAGCCTGGTCTTTTTACAATCCAGTTGGAGGGCGAACCT




Most similar to sp|Q39746|RBS4_FLAPR