miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse :: Contigs




EST name EST sequence
gi|90459166|gb|DY921045.1|DY921045 ACTTTACTCTTGCTCTCCCTCTTAACAGTATCATCATCATCATCATCTGGGTTTGATCAGTTTCTTCAACAATCATCATC
ATCAAACTCATGGGTGCTTGTGTTTCAAATCACCAGAAACCTTCTGGGAAGAAGGTTCAGGCGTTATATAATGGGTCTAA
TGATATTGTTAAACCTCCCATCATAAATGGTGATCTTGCTAATAAGTCTAAGTGGTCTCCCTCCAAATCAGCACCTTCTT
TTCAAGATTTTGGTAGTAAAGAGGAGACGTTTTTTGACTCACAAGCATGGTTAGATTCAGATTGTGACGATGATTTCATG
AGTGTTAACGGTGAATTTACCCCATCAAGAGGCAATACGCCGGTCCACCATAACTTCTCTGCAGGCAACAATAAACCTCC
GGTTGCTATTTCCCCAAACCAACCATCTCCACATGGGCAAGAAAAGAAAATGAGACTTTCTGATCTTTTCAATGATAGTC
TAAGAGGAAACTATGATTCTGATAATGAGGATGATGGTGAGGCAGTGAAAAGTGGGGTGAACTCAAAGAATGAAAGCCCT
CTTGTGCGTGGCGATGAAGTGGCGCCAAACGGTGGTAATGTGTTGAAAACAAAGAGGGAGAGATTTGGGAGTTGTTTTCC
AAGTTTGCTTTCTTCTAGCCGTAGCTCGTCAATGAACGGAAGGAAGATGATGAGCCCGAGCCCAAATCCTGTTGCAGCGT
AATGAGCTAGCCATGAGCCATCGGGTTGAATGTATAGTAAAGATGAATGTGTAAAGCCGAATAACTTGTCTTATGGTTGA
GTATTTAAGATATGCAACAAGTATATGTTTTCTAGAGGGAGTATGTATGTCAAGATTTTTGTTATAAAGAAAACCTGCAT
TGCT