miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST000711
species: Gerbera hybrid cultivar
miRNA family: MIR414
source: miRNEST

Taxonomy by NCBI:
Gerbera hybrid cultivar Gerbera Mutisieae Mutisioideae Asteraceae Asterales campanulids asterids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
GCATCATCATCATCATCATAA

miRNA*
GTGATGAGGAAGATGGCGCAA

mismatches: 5
bulges: 0

View larger
pre-miRNA
AGGAGACACTCCAAGCTCAGGAAACATCGTAATAGACGAATGGATTCTTCAAGTGATGAGGAAGATGGCGCAACGAGGAAGAGAAGACATTCGAGGCATC
ATCATCATCATCATAA
ACGCCATAGACGTTCGGATTCAAGTGAATCGGATTCTTTAAGGCAGCAT


dot-bracket secondary structure
.((((...)))).......((((.((((((.....))).)))..))))....(((((((.((.(((((.((..((((............))))..)).))
))).)).)))))))..
..(((.((((...((.(((((....))))).))...)))).))).....



SIMILARITIES
miRBase no hits

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits
most similar mature miRNAs

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: not a miRNA
Source sequences
download this record





Liczniki na strone;