miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST000857
species: Oryza sativa
miRNA family: MIRf75
source: miRNEST

Taxonomy by NCBI:
Oryza sativa Oryza Oryzeae Ehrhartoideae BEP clade Poaceae Poales commelinids Liliopsida Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
CACGAGACGAATCTTTTGAGC

miRNA*
TCAAAAGATTCGTTTCACGGT

mismatches: 3
bulges: 0

View larger
pre-miRNA
GGAGCATTAAATATAGATAAAAAAAACTAATTGGACAGTTATGATGGAAATCACGAGACGAATCTTTTGAGCCTAATTAGTCCATGATTAGCCATAAGTG
CTACAGTAACCCACATGTGCTAATGGTGGATTAATTAGTCTCAAAAGATTCGTTTCACGGTTTCCAGGCGAGTTATGAAATTAGTTTTTTAATTTGTGTT
CG


dot-bracket secondary structure
.........(((((((((..((((((((((((.(((.(((....((((((((..(((((((((((((((((.(((((((((((((.((((((.(((.(((
...........))).))))))))).))))))))))))).)))))))))))))))))..)))))))))))..)))....)))))))))))).)))))))))
..



SIMILARITIES
miRBase osa-MIR2124a: 0.0000000007

PMRD osa-miRf10240-akr: 1e-39

microPC no hits
UniProt no hits

RFAM no hits
most similar mature miRNAs

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;