miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST000883
species: Helianthus petiolaris
miRNA family: MIR162
source: miRNEST

Taxonomy by NCBI:
Helianthus petiolaris Helianthus Heliantheae Heliantheae alliance Asteroideae Asteraceae Asterales campanulids asterids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TCGATAAACCTCTGCATCCA

miRNA*
GATTCAGCGGTTCATCGATC

mismatches: 3
bulges: 0

View larger
pre-miRNA
TTATTGTCATTTGTGTTCCGTAGAGGATCACTGGATTCAGCGGTTCATCGATCTGTTCCATAATCCTAATGATTAAATGTTCATACGACGATTGAGAGAG
GTGGGAAATGGAATCGATCGATAAACCTCTGCATCCAGTGTTCTTCCTGCTTAGCACGATCTTGTTT


dot-bracket secondary structure
.......((.(((((((..((((((((.((((((((.(((.((((.(((((((.(((((((..(((((....((((.((((.....)))).)))).....
.))))).))))))).))))))).)))).))).)))))))).)))).))))..)))))))...))...



SIMILARITIES
miRBase osa-MIR162a: 0.0000000006

PMRD osa-miR162a: 0.0000000006

microPC miR162: 2e-56
UniProt no hits

RFAM MIR162_2: 0.00000001
most similar mature miRNAs

Identical with: miR162 from microPC (MNEST045991)

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;