miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST000899
species: Helianthus tuberosus
miRNA family: MIR393
source: miRNEST

Taxonomy by NCBI:
Helianthus tuberosus Helianthus Heliantheae Heliantheae alliance Asteroideae Asteraceae Asterales campanulids asterids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TCCAAAGGGATCGCATTGATC

miRNA*
TCATGCGATCTCTTCGGAAG

mismatches: 1
bulges: 1

View larger
pre-miRNA
CAGCGGGTTGAAGCTTCCAAAGGGATCGCATTGATCCATCTGTCCACTCGGATTTCAATCTCAGTTGATAATTTGGATCATGCGATCTCTTCGGAAGCTT
CCTCCATCG


dot-bracket secondary structure
....(((..(((((((((.((((((((((((.((((((..((((.(((.((((....)))).))).))))...)))))))))))))))))).))))))))
).)))....



SIMILARITIES
miRBase zma-MIR393b: 0.0000003

PMRD zma-miR393f: 0.0000003

microPC miR393: 5e-40
UniProt no hits

RFAM no hits
most similar mature miRNAs

Identical with: miR393 from microPC (MNEST044833)

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;