miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST001094
species: Hordeum vulgare
miRNA family: MIRf341
source: miRNEST

Taxonomy by NCBI:
Hordeum vulgare Hordeum Triticeae Pooideae BEP clade Poaceae Poales commelinids Liliopsida Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
CTCCGTTCCTAAATATAAGTC

miRNA*
CTTATATTTAGGAATAGAGGG

mismatches: 1
bulges: 0

View larger
pre-miRNA
CCGGCGCCTATTACTCCCTCCGTTCCTAAATATAAGTCTTTTAAGAGATTTCACTAATGGTCTACATACGGATCAAAATGAGTGAATCTACATTTTAAAA
TATGTCTATATACATCCGTACGTAGTTCATTAGTAAAATCGTTAGAAAGACTTATATTTAGGAATAGAGGGAGTAGTCTATTACT


dot-bracket secondary structure
.........(((((((((((.(((((((((((((((((((((.((.(((((.((((((((.((((.(((((((((...)))(((.((..((((.......
.))))..)).))).)))))).)))).)))))))).))))).)).))))))))))))))))))))).)))))))))))........



SIMILARITIES
miRBase tae-MIR1126: 5e-23

PMRD tae-miR1126: 5e-23

microPC miR1436: 5e-29
UniProt no hits

RFAM MIR1122: 3e-46
most similar mature miRNAs

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
degradome data
download this record





Liczniki na strone;