miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST001132
species: Hordeum vulgare
miRNA family: MIR1122
source: miRNEST

Taxonomy by NCBI:
Hordeum vulgare Hordeum Triticeae Pooideae BEP clade Poaceae Poales commelinids Liliopsida Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TACTCCCTCCATCCCAAAATA

miRNA*
TTTTGGGACAGGGGGAGTAGA

mismatches: 2
bulges: 0

View larger
pre-miRNA
GCAATGTACTCCCTCCATCCCAAAATAAGTGACGCAAATTTAGTACTAAGTTAGTACAAATATAATACTAAAGCAGCGACATTTATTTTGGGACAGGGGG
AGTAGA
ACA


dot-bracket secondary structure
......(((((((((..((((((((((((((.(((...(((((((.((.(((......))).)).)))))))...))).))))))))))))))..)))))
))))..
...



SIMILARITIES
miRBase no hits

PMRD hpr-miR1120: 0.00000002

microPC miR1439: 0.000005
UniProt no hits

RFAM MIR1122: 3e-35
most similar mature miRNAs

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;