miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST001543
species: Mesembryanthemum crystallinum
miRNA family: MIRf133
source: miRNEST

Taxonomy by NCBI:
Mesembryanthemum crystallinum Mesembryanthemum Aizoaceae Caryophyllales core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TACCGGTGGAGGAGAGAGAAA

miRNA*
TCTCTCTCTTCCATTGTCTCT

mismatches: 4
bulges: 0

View larger
pre-miRNA
TGGCTTTCTCTCTCTTCCATTGTCTCTGCTCTGCTCGGTCAGTAAGGTGATGGCGGCGATTCAGATGAGAGCGGTGGTGGCCGAGGGTGGCTACCAGCCT
CGATCGTCATCGGTTCGAGTGATCGATGTCGATGAGGAGATGGCGGCGCAGAGGAATAAGAGGCGGCGGAGGAGGGTGGTACCGGTGGAGGAGAGAGAAA
ATGGTGGTG


dot-bracket secondary structure
..((((((((((((((((((((...(((((((.(((.((((......)))).((.((.((((...((...((..(((((((((....)))))))))(((.
...((.(((((((.((((....))))..))))))).))...))).)).))...)))).....)).)).))).)))))))...))))))))))))))))).
..)))....



SIMILARITIES
miRBase no hits

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits
most similar mature miRNAs

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: not a miRNA
Source sequences
download this record





Liczniki na strone;