miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST001808
species: Panicum virgatum
miRNA family: MIR1439
source: miRNEST

Taxonomy by NCBI:
Panicum virgatum Panicum Paniceae Panicoideae PACCAD clade Poaceae Poales commelinids Liliopsida Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TTTTGGAACGGAGGGAGTATA

miRNA*
TACTCCCTCCGTTCCAAAATG

mismatches: 3
bulges: 0

View larger
pre-miRNA
CATTTACCAGCTGGCATGCTTGCTACTCCCTCCGTTCCAAAATGTAGATCGTTTTGACTTTTCTAGATTCATAGTGTTTGCTATGCATCTAGATATAACA
TATGTCTAGATACATAGCAAAATATATGAATCTAAAAAAGTCAAAACGACCTATATTTTGGAACGGAGGGAGTATATCTTATGTCACCCTTTTATG


dot-bracket secondary structure
...........(((((((.....((((((((((((((((((((((((.((((((((((((((.((((((((((...(((((((((.(((((((((((...
))))))))))).)))))))))...)))))))))).)))))))))))))).)))))))))))))))))))))))).....)))))))..........



SIMILARITIES
miRBase tae-MIR1137: 0.0002

PMRD osa-miRf11780-akr: 0.000003

microPC miR1439: 0.0000002
UniProt no hits

RFAM MIR1122: 6e-23
most similar mature miRNAs

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;