miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST002800
species: Triticum turgidum subsp. durum
miRNA family: MIRf341
source: miRNEST

Taxonomy by NCBI:
Triticum turgidum subsp. durum Triticum turgidum Triticum Triticeae Pooideae BEP clade Poaceae Poales commelinids Liliopsida Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
CCTCCGTCCCATAATAAGTGT

miRNA*
AGTTATTTTGGGACGGAGGGA

mismatches: 2
bulges: 0

View larger
pre-miRNA
TATATACTATTCCTCCGTCCCATAATAAGTGTCTCAACTTTGTAGTAACTCTAGTACAAAGTTGTACTAAGCTTGAGACAGTTATTTTGGGACGGAGGGA
GTACTATA


dot-bracket secondary structure
....((((..((((((((((((.(((((.(((((((((((.(((.(((((.........)))))))).))).)))))))).))))).)))))))))))))
))).....



SIMILARITIES
miRBase osa-MIR1862e: 0.00002

PMRD osa-miRf10099-akr: 0.000001

microPC miR1439: 1e-25
UniProt no hits

RFAM MIR1122: 5e-34
most similar mature miRNAs

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;