miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST002804
species: Triticum turgidum subsp. durum
miRNA family: MIR1120
source: miRNEST

Taxonomy by NCBI:
Triticum turgidum subsp. durum Triticum turgidum Triticum Triticeae Pooideae BEP clade Poaceae Poales commelinids Liliopsida Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TCCCTCTGTAAAGAAATATAA

miRNA*
ATATTTCTTTACAGAAGGAGT

mismatches: 1
bulges: 0

View larger
pre-miRNA
AATCTAGCTTCTAAAAGGTACTCCCTCTGTAAAGAAATATAAAAGCGTTTATTAGATCACTGAAGTAGTGATCTAAATGTTCTTATATTTCTTTACAGAA
GGAGT
AACTTGCTAGATGGCATG


dot-bracket secondary structure
.(((((((......(((.((((((.(((((((((((((((((.((((((...((((((((((...)))))))))))))))).))))))))))))))))).
)))))
).))))))))))......



SIMILARITIES
miRBase tae-MIR1121: 7e-18

PMRD tae-miR1121: 7e-18

microPC miR1121: 0.00002
UniProt no hits

RFAM MIR1122: 2e-21
most similar mature miRNAs

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;