miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST007170
species: Bombyx mori
miRNA family: miR-2808a
source: miRNEST

Taxonomy by NCBI:
Bombyx mori Bombyx Bombycinae Bombycidae Bombyciformes Bombycoidea Obtectomera Ditrysia Heteroneura Neolepidoptera Glossata Lepidoptera Amphiesmenoptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
CGGTGGTAGATTCAGCGAAGA

miRNA*
TCGCCGGATCTTCTCAGTGGG

mismatches: 3
bulges: 2

View larger
pre-miRNA
CCACTGAGTTTCTCGCCGGATCTTCTCAGTGGGTCGCGTTTCCGATCCGGTGGTAGATTCAGCGAAGACTGCTCTTG

dot-bracket secondary structure
.....((((.((((((.((((((..(((.(((((((......))))))).))).)))))).))).)))..))))...


SIMILARITIES
miRBase bmo-mir-2808a-1: 2e-23

PMRD no hits

microPC no hits
UniProt no hits

RFAM U2: 3e-28
most similar mature miRNAs

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;