miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST008379
species: Medicago truncatula
miRNA family: MIR166
source: miRNEST

Taxonomy by NCBI:
Medicago truncatula Medicago Trifolieae Papilionoideae Fabaceae Fabales fabids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TCGGACCAGGCTTCATTCCTC

miRNA*
GGAATGAGGTTTGTTCCAAGA

mismatches: 4
bulges: 0

View larger
pre-miRNA
TTTGGAATGAGGTTTGTTCCAAGATCATCACACATCATGTTTCTTCTTCCCTTTCAATAATTCTTGATTAATTTATGTTCATACATCTATATATATATCT
ATATATATTATCAAGTCATTACATGCATGGGATGAGATATTGAGAGTGATCTCGGACCAGGCTTCATTCCTC


dot-bracket secondary structure
...(((((((((((((.(((.(((((((......(((((((((....((((...((.((((.((((((.(((.(((((..(((.((......)).)))..
))))).)))))))))..))))..))...)))).)))))).)))..))))))).))).)))))))))))))..



SIMILARITIES
miRBase mtr-MIR166f: 1e-51

PMRD mtr-miR166c: 4e-51

microPC miR166: 0.0000006
UniProt no hits

RFAM mir-166: 2e-50
most similar mature miRNAs

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;