miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST008387
species: Medicago truncatula
miRNA family: MIR1439
source: miRNEST

Taxonomy by NCBI:
Medicago truncatula Medicago Trifolieae Papilionoideae Fabaceae Fabales fabids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
ATTTGGGACGGAGGGAGTATG

miRNA*
TACTCCCTCCGTCCCAAATTG

mismatches: 0
bulges: 0

View larger
pre-miRNA
ATGAGTCGTGAATATATTATACTCCCTCCGTCCCAAATTGTATGACGTTTTAGACATTTCACATATATTAAAAAATGTAATATATTTTGTGTGGAAAAGA
GATATTATGAGTTGTTTTACAAAATTGTCCTTAATAAATGATATGGGAAAGATAAATGAAAGAATTGAAAGAAGAGAAAGTAATAAATAGTTAAGGATAT
AATAGGAAAAATAACATTAATGTTTCATTGGTATTGTAAAGCAACATATAATTTGGGACAAAATTTTTCTCCAAAGCGACATACAATTTGGGACGGAGGG
AGTATG
ATTTTTCTAATGTTTC


dot-bracket secondary structure
.........(((...(((((((((((((((((((((((((((((.((((((..((((.....((((((((.......))))))))...))))(((((((.
...((((((.((((((((((((.(((.((((..((.....))..))))..))).(((((((..(((((................................
................))))).)))))))....)))))))))))).))))))...........)))))))..)))))).)))))))))))))))))))))
))))))
))..))).........



SIMILARITIES
miRBase tae-MIR1122: 0.0003

PMRD osa-miRf10302-akr: 0.00007

microPC no hits
UniProt no hits

RFAM MIR1122: 0.00008
most similar mature miRNAs

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;