miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST008395
species: Medicago truncatula
miRNA family: MIRf341
source: miRNEST

Taxonomy by NCBI:
Medicago truncatula Medicago Trifolieae Papilionoideae Fabaceae Fabales fabids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TACTCCCTCCGTCCCTAATTA

miRNA*
ATTANGGACGGAANGAGTAAT

mismatches: 3
bulges: 0

View larger
pre-miRNA
CAATCCAAAATTCTTAAATAATACTCCCTCCGTCCCTAATTANAAGACCCTTTTGCTTTGCTAAAATCACGGGAATTAAGAAAGCGGATATTTGTATTAA
AGTTGTTTGTAATCACTGTTGTTTTTACAATTTTATCCTTAAGAGAGAAGGTTAGTTTATGTTTTCCATATGCTACTTATTGCTGATTGAAGAAAAAGAT
GTATAATAAATAAGGGCATGTATGTAAAGAAATAATTAATGTAGTTGAAAATAACAAAGGGGTCTTATAAAAAAAGACAAAAAAATCTCAAAAGGCTCTT
ATAATTANGGACGGAANGAGTAATAANTTATAATCATTCACT


dot-bracket secondary structure
..............(((.((.(((((..(((((((.((((((.((((.(((((((((((.((.((.((....)).)).))))))).((((....))))..
.(((((((.((((..((.(((((..((((.((((.((.((((.((.((.((.((((.((((.....)))).)))).)).)).))..)))).)).)))).)
))).)))))...)).((((.(((........)))....)))).)))).)))))))..(((.(((((.......))))).......))).)))))).))))
.)))))).)))))))..))))).))..)))............



SIMILARITIES
miRBase no hits

PMRD no hits

microPC no hits
UniProt no hits

RFAM MIR1122: 0.00008
most similar mature miRNAs

MORE

miRNEST target predictions
non-miRNEST targets: none
Source sequences
download this record





Liczniki na strone;