miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST024786
species: Branchiostoma floridae
source: miRBase, original name: bfl-mir-4898 (MI0017672)

Taxonomy by NCBI:
Branchiostoma floridae Branchiostoma Branchiostomidae Cephalochordata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
GCTGTCCTGCGGCTGGTGGGAGGT

miRNA*
CGTCATGCGAGCCGCAGCTGGCCA

mismatches: 5
bulges: 2

View larger
pre-miRNA
CTGGGACACCAGTGTGTGACGTCATGCGAGCCGCAGCTGGCCAAGCAGGCTGTCCTGCGGCTGGTGGGAGGTACCACTGTGTTTGAG

dot-bracket secondary structure
((.((((((.((((.(((.(.((..((.((((((((.(((((.....)))))..)))))))).))..)).)))))))))))))).))


SIMILARITIES
miRBase no hits

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: 454

references

[1] Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M, Evol Dev. 13:15-27(2011)., "microRNA complements in deuterostomes: origin and evolution of microRNAs"




Liczniki na strone;