ABOUT THIS RECORDspecies: Gallus gallus
miRNA family: mir-22
source: miRBase, original name: gga-mir-22 (MI0006982)
Taxonomy by NCBI:
Gallus gallus Gallus Phasianinae Phasianidae Galliformes Neognathae Aves Coelurosauria Theropoda Saurischia Dinosauria Archosauria Sauria Sauropsida Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA AAGCTGCCAGTTGAAGAACTGT miRNA* AGTTCTTCAGTGGCAAGCTTTA mismatches: 0 bulges: 2 |
pre-miRNA
GCTCCTGGCTGCCCGGCAGCAGTTCTTCAGTGGCAAGCTTTATGTCCTTCTCTAGTAGCTAAAGCTGCCAGTTGAAGAACTGTTGAATGTAGCCACGTTC
dot-bracket secondary structure
.....(((((((....(((((((((((((((((((.((((((.((.((.....))..))))))))))))).))))))))))))))...))))))).....
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Northern, Solexa
deep sequencing data evidence
references
[1] Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach"
[2] Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH, Gene. 418:34-40(2008)., "Identification of novel chicken microRNAs and analysis of their genomic organization"
[3] Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ, Genome Res. 18:995-1004(2008)., "Conservation of small RNA pathways in platypus"
[4] Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V, J Virol. 82:4007-4015(2008)., "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
GCTCCTGGCTGCCCGGCAGCAGTTCTTCAGTGGCAAGCTTTATGTCCTTCTCTAGTAGCTAAAGCTGCCAGTTGAAGAACTGTTGAATGTAGCCACGTTC
dot-bracket secondary structure
.....(((((((....(((((((((((((((((((.((((((.((.((.....))..))))))))))))).))))))))))))))...))))))).....
SIMILARITIES| miRBase dre-mir-22a: 9e-20 PMRD no hits microPC no hits | UniProt no hits RFAM mir-22: 1e-43 |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Northern, Solexa
deep sequencing data evidence
references
[1] Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach"
[2] Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH, Gene. 418:34-40(2008)., "Identification of novel chicken microRNAs and analysis of their genomic organization"
[3] Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ, Genome Res. 18:995-1004(2008)., "Conservation of small RNA pathways in platypus"
[4] Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V, J Virol. 82:4007-4015(2008)., "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
