miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST028181
species: Macaca nemestrina
miRNA family: mir-22
source: miRBase, original name: mne-mir-22 (MI0002636)

Taxonomy by NCBI:
Macaca nemestrina Macaca Cercopithecinae Cercopithecidae Cercopithecoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
AAGCTGCCAGTTGAAGAACTGT

miRNA*
AGTTCTTCAGTGGCAAGCTTTA

mismatches: 0
bulges: 2

View larger
pre-miRNA
GGCTGAGCCGCAGTAGTTCTTCAGTGGCAAGCTTTATGTCCTGACCCAGCTAAAGCTGCCAGTTGAAGAACTGTTGCCCTCTGCC

dot-bracket secondary structure
(((.(((..((((((((((((((((((((.((((((.((.........))))))))))))).))))))))))))))).))).)))


SIMILARITIES
miRBase eca-mir-22: 4e-43

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-22: 7e-42

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record

references

[1] Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes"




Liczniki na strone;