miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST028186
species: Macaca nemestrina
miRNA family: mir-26
source: miRBase, original name: mne-mir-26a (MI0002645)

Taxonomy by NCBI:
Macaca nemestrina Macaca Cercopithecinae Cercopithecidae Cercopithecoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TTCAAGTAATCCAGGATAGGCT

miRNA*
CCTATTCTTGATTACTTGCACG

mismatches: 2
bulges: 0

View larger
pre-miRNA
GTGGCCTCGTTCAAGTAATCCAGGATAGGCTGTGCAGGTCCCAATGGGCCTATTCTTGATTACTTGCACGGGGACGC

dot-bracket secondary structure
(((.((((((.(((((((((.((((((((((.((.......))...)))))))))).))))))))).)))))).)))


SIMILARITIES
miRBase lla-mir-26a: 5e-36

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-26: 3e-28

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record

references

[1] Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes"




Liczniki na strone;