miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST028232
species: Macaca nemestrina
miRNA family: mir-204
source: miRBase, original name: mne-mir-204 (MI0002842)

Taxonomy by NCBI:
Macaca nemestrina Macaca Cercopithecinae Cercopithecidae Cercopithecoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TTCCCTTTGTCATCCTATGCCT

miRNA*
GCTGGGAAGGCAAAGGGACGT

mismatches: 2
bulges: 1

View larger
pre-miRNA
GGCTACAGTCTTTCTTCATGTGACTCGTGGACTTCCCTTTGTCATCCTATGCCTGAGAATATATGAAGGAGGCTGGGAAGGCAAAGGGACGTTCAATTGT
CATCACTGGC


dot-bracket secondary structure
(((....))).....(((((((((...(((((.((((((((((.(((((.((((...............))))))))).)))))))))).)))))...))
)).)).))).



SIMILARITIES
miRBase sla-mir-204: 6e-58

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-204: 2e-42

Identical with: eca-mir-204b-2 from miRBase (MNEST027090)

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record

references

[1] Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes"




Liczniki na strone;