ABOUT THIS RECORDspecies: Homo sapiens
miRNA family: mir-484
source: miRBase, original name: hsa-mir-484 (MI0002468)
Taxonomy by NCBI:
Homo sapiens Homo Homininae Hominidae Hominoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA TCAGGCTCAGTCCCCTCCCGAT miRNA* CGGGGGGTGACCCTGGCT mismatches: 3 bulges: 4 |
pre-miRNA
AGCCTCGTCAGGCTCAGTCCCCTCCCGATAAACCCCTAAATAGGGACTTTCCCGGGGGGTGACCCTGGCTTTTTTGGCG
dot-bracket secondary structure
.(((..((((((....(((.(((((((..(((.((((....))))..)))..))))))).)))))))))......))).
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Northern
references
[1] Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X, FEBS Lett. 579:3849-3854(2005)., "Identification of human fetal liver miRNAs by a novel method"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"
AGCCTCGTCAGGCTCAGTCCCCTCCCGATAAACCCCTAAATAGGGACTTTCCCGGGGGGTGACCCTGGCTTTTTTGGCG
dot-bracket secondary structure
.(((..((((((....(((.(((((((..(((.((((....))))..)))..))))))).)))))))))......))).
SIMILARITIES| miRBase ppy-mir-484: 1e-39 PMRD no hits microPC no hits | UniProt no hits RFAM mir-484: 5e-24 |
Identical with: ptr-mir-484 from miRBase (MNEST030387) |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Northern
references
[1] Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X, FEBS Lett. 579:3849-3854(2005)., "Identification of human fetal liver miRNAs by a novel method"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"
