miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST029831
species: Homo sapiens
source: miRBase, original name: hsa-mir-4683 (MI0017315)

Taxonomy by NCBI:
Homo sapiens Homo Homininae Hominidae Hominoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TGGAGATCCAGTGCTCGCCCGAT

miRNA*
GAGGCGGGCCTGGAGGTGCACC

mismatches: 4
bulges: 2

View larger
pre-miRNA
GACACGCAAGACGAGGCGGGCCTGGAGGTGCACCAGTTCTGGCCGCTGGTGGAGATCCAGTGCTCGCCCGATCTCAAGTTC

dot-bracket secondary structure
...((...(((((.((((((((((((..(.(((((((.......))))))).)..))))).))))))))).)))...))..


SIMILARITIES
miRBase no hits

PMRD no hits

microPC no hits
UniProt sp|Q498S8|FZD8_RAT: 0.0000000009

RFAM no hits

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa

references

[1] Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"




Liczniki na strone;