miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST032229
species: Mus musculus
miRNA family: mir-654
source: miRBase, original name: mmu-mir-654 (MI0005520)

Taxonomy by NCBI:
Mus musculus Mus Mus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TATGTCTGCTGACCATCACCTT

miRNA*
AAGTGGGAAGATGGTAAGCTGCAGAACATGTG

mismatches: 4
bulges: 6

View larger
pre-miRNA
CTCGGTAAGTGGGAAGATGGTAAGCTGCAGAACATGTGTGTTTCTCATGTCATATGTCTGCTGACCATCACCTTTGGGTCTCTG

dot-bracket secondary structure
(((((.....((...((((((.....(((((.((((((............)))))))))))..)))))).)).)))))......


SIMILARITIES
miRBase mmu-mir-654: 2e-42

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-654: 3e-41

MORE

miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa

references

[1] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[2] Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"




Liczniki na strone;