miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST032417
species: Mus musculus
source: miRBase, original name: mmu-mir-1897 (MI0008314)

Taxonomy by NCBI:
Mus musculus Mus Mus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
CTTTGGATGGAGAAAGAGGGGG

miRNA*
TCAACTCGTTCTGTCCGGTGAG

mismatches: 5
bulges: 0

View larger
pre-miRNA
ATTCTCCGTGCTTTGGATGGAGAAAGAGGGGGGAAGTGCGAGCTCCTTCAACTCGTTCTGTCCGGTGAGGAGTGATCCA

dot-bracket secondary structure
...((((...(.((((((((((..((..((((((.((....))))))))..))..)))))))))).).)))).......


SIMILARITIES
miRBase mmu-mir-1897: 1e-39

PMRD no hits

microPC no hits
UniProt no hits

RFAM SOX2OT_exon3: 2e-38

MORE

miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: microarray, PCR

references

[1] He S, Su H, Liu C, Skogerbo G, He H, He D, Zhu X, Liu T, Zhao Y, Chen R, BMC Genomics. 9:236(2008)., "MicroRNA-encoding long non-coding RNAs"




Liczniki na strone;