ABOUT THIS RECORDspecies: Rattus norvegicus
miRNA family: mir-17
source: miRBase, original name: rno-mir-18a (MI0000846)
Taxonomy by NCBI:
Rattus norvegicus Rattus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA TAAGGTGCATCTAGTGCAGATAG miRNA* ACTGCCCTAAGTGCTCCTTCTGGC mismatches: 4 bulges: 3 |
pre-miRNA
TGCGTGCTTTTTGTTCTAAGGTGCATCTAGTGCAGATAGTGAAGTAGACTAGCATCTACTGCCCTAAGTGCTCCTTCTGGCATAAGAAGTTATGTC
dot-bracket secondary structure
.(((((((((((((.((((((.(((..(((.((((.(((((.((....))..)).))))))).)))..))).)))..))).)))))))).))))).
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, SOLiD
references
[1] Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G, Proc Natl Acad Sci U S A. 101:360-365(2004)., "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
[4] Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T, Curr Biol. 12:735-739(2002)., "Identification of tissue-specific microRNAs from mouse"
TGCGTGCTTTTTGTTCTAAGGTGCATCTAGTGCAGATAGTGAAGTAGACTAGCATCTACTGCCCTAAGTGCTCCTTCTGGCATAAGAAGTTATGTC
dot-bracket secondary structure
.(((((((((((((.((((((.(((..(((.((((.(((((.((....))..)).))))))).)))..))).)))..))).)))))))).))))).
SIMILARITIES| miRBase mmu-mir-18a: 1e-49 PMRD no hits microPC no hits | UniProt no hits RFAM no hits |
Identical with: mmu-mir-18a from miRBase (MNEST031780) |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, SOLiD
references
[1] Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G, Proc Natl Acad Sci U S A. 101:360-365(2004)., "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
[4] Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T, Curr Biol. 12:735-739(2002)., "Identification of tissue-specific microRNAs from mouse"
