miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST035083
species: Acyrthosiphon pisum
miRNA family: mir-67
source: miRBase, original name: api-mir-307-1 (MI0013930)

Taxonomy by NCBI:
Acyrthosiphon pisum Acyrthosiphon Macrosiphini Aphidinae Aphididae Aphidoidea Aphidomorpha Aphidiformes Sternorrhyncha Hemiptera Paraneoptera Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
CCACAACCTCCTTGAGTGAGCGA

miRNA*
ACTCACTCAATTTGGATGTGATG

mismatches: 8
bulges: 0

View larger
pre-miRNA
ACTCACTCAATTTGGATGTGATGTTCAAATTGGCGCCACCACAACCTCCTTGAGTGAGCGA

dot-bracket secondary structure
.(((((((((...((.((((.((.((.....))...)).)))).))...)))))))))...


SIMILARITIES
miRBase api-mir-307-2: 5e-29

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-67: 1e-27

Identical with: api-mir-307-2 from miRBase (MNEST035084)

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa

references

[1] Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S, BMC Genomics. 11:281(2010)., "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum"




Liczniki na strone;