miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST035093
species: Acyrthosiphon pisum
source: miRBase, original name: api-mir-981 (MI0013938)

Taxonomy by NCBI:
Acyrthosiphon pisum Acyrthosiphon Macrosiphini Aphidinae Aphididae Aphidoidea Aphidomorpha Aphidiformes Sternorrhyncha Hemiptera Paraneoptera Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TTCGTTGTCGATGAAACCTTGA

miRNA*
TGGGTTTCTTGATGACTGGGACC

mismatches: 5
bulges: 3

View larger
pre-miRNA
TGGGTTTCTTGATGACTGGGACCTTGACATTATATTAATATGGTTCGTTGTCGATGAAACCTTGA

dot-bracket secondary structure
.(((((((((((..((..(((((..................)))))))..)))).)))))))...


SIMILARITIES
miRBase no hits

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa
deep sequencing data evidence

references

[1] Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S, BMC Genomics. 11:281(2010)., "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum"




Liczniki na strone;