miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST035294
species: Anopheles gambiae
miRNA family: mir-190
source: miRBase, original name: aga-mir-190 (MI0010594)

Taxonomy by NCBI:
Anopheles gambiae gambiae species complex Pyretophorus Cellia Anopheles Anophelinae Culicidae Culicoidea Culicimorpha Nematocera Diptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
AGATATGTTTGATATTCTTGGTTG

miRNA*
CCCAGGAATCAAACATATTATTA

mismatches: 1
bulges: 3

View larger
pre-miRNA
TGTTTGGTGGGACAGTTTCGGTGAGATATGTTTGATATTCTTGGTTGTTAAGATTTCAATTATCACCCAGGAATCAAACATATTATTACCGTGACTGTCG
T


dot-bracket secondary structure
..........(((((((.((((((((((((((((((..((((((.((.(((........))).)).)))))))))))))))))).)))))).))))))).
.



SIMILARITIES
miRBase aae-mir-190: 4e-25

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-190: 2e-45

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record

references

[1] Griffiths-Jones S, Unpublished (2009).,




Liczniki na strone;