miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST035321
species: Anopheles gambiae
miRNA family: mir-965
source: miRBase, original name: aga-mir-965-1 (MI0010602)

Taxonomy by NCBI:
Anopheles gambiae gambiae species complex Pyretophorus Cellia Anopheles Anophelinae Culicidae Culicoidea Culicimorpha Nematocera Diptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TAAGCGTATAGCTTTTCCCATT

miRNA*
AGGGGAATGCTGTACACTCTATG

mismatches: 3
bulges: 1

View larger
pre-miRNA
CGAAGTAAATCGACGAATTCTGAAAGGGGAATGCTGTACACTCTATGTGCTAAAAATATCCATAAGCGTATAGCTTTTCCCATTTAGCGTTCGTTGCGAG
CAAA


dot-bracket secondary structure
....((....((((((((.(((((.((((((.(((((((.((.((((.(.((....)).))))))).))))))).)))))).))))).))))))))...)
)...



SIMILARITIES
miRBase aga-mir-965-2: 2e-54

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits

Identical with: aga-mir-965-2 from miRBase (MNEST035322)

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record

references

[1] Griffiths-Jones S, Unpublished (2009).,




Liczniki na strone;