miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST035393
species: Apis mellifera
miRNA family: mir-316
source: miRBase, original name: ame-mir-316 (MI0010619)

Taxonomy by NCBI:
Apis mellifera Apis Apini Apinae Apidae Apoidea Aculeata Apocrita Hymenoptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TGTCTTTTTCCGCTTTGCTGCCG

miRNA*
AGCAAAGGGGAACAGGCCGA

mismatches: 4
bulges: 1

View larger
pre-miRNA
GTGTGGCCGAGGGTGTGTCTTTTTCCGCTTTGCTGCCGCTGAAATGGAGTCCGCCAGCAAAGGGGAACAGGCCGACCCTCCCGCACCAA

dot-bracket secondary structure
((((((..((((((..((((.(((((.((((((((..((.((.......)).))))))))))))))).))))..))))))))))))...


SIMILARITIES
miRBase tca-mir-316: 0.00000002

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record

references

[1] Griffiths-Jones S, Unpublished (2009).,




Liczniki na strone;