miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST035415
species: Apis mellifera
miRNA family: mir-2796
source: miRBase, original name: ame-mir-2796 (MI0016221)

Taxonomy by NCBI:
Apis mellifera Apis Apini Apinae Apidae Apoidea Aculeata Apocrita Hymenoptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
GTAGGCCGGCGGAAACTACTTGC

miRNA*
TAGGGGTTTCTATCGGCCTCCAG

mismatches: 6
bulges: 0

View larger
pre-miRNA
AAGGAGGGAAGAGAAGGAACGTAGCGATAAGGTTAGGGGTTTCTATCGGCCTCCAGCAGCAACGATGGTTGTAGGCCGGCGGAAACTACTTGCTCTTGTC
GCTAACGATCGTCGGCCCGAAAGATCCA


dot-bracket secondary structure
..((((((....((..((.((((((((((((((.((..((((((..((((((.((((..........)))).))))))..))))))..)).)).))))))
))).))).)).))..)))......))).



SIMILARITIES
miRBase nvi-mir-2796: 1e-22

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: SOLID

references

[1] Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F, Insect Mol Biol. 19:799-805(2010)., "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera"




Liczniki na strone;