miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST036003
species: Culex quinquefasciatus
miRNA family: mir-1
source: miRBase, original name: cqu-mir-1 (MI0013566)

Taxonomy by NCBI:
Culex quinquefasciatus Culex pipiens complex Culex Culex Culicini Culicinae Culicidae Culicoidea Culicimorpha Nematocera Diptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TGGAATGTAAAGAAGTATGGAG

miRNA*
CCATGCTTCCTTGCATTCAATA

mismatches: 2
bulges: 0

View larger
pre-miRNA
GCGAAAGTTCCATGCTTCCTTGCATTCAATAGTGATCTTTGAAACGTATGGAATGTAAAGAAGTATGGAGCGCTCGG

dot-bracket secondary structure
.(((..((((((((((((.((((((((.(((((..........)).))).)))))))).))))))))))))..))).


SIMILARITIES
miRBase aae-mir-1: 4e-24

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-1: 8e-23

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa

references

[1] Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR, BMC Genomics. 11:119(2010)., "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"




Liczniki na strone;