miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST036240
species: Drosophila grimshawi
miRNA family: mir-3
source: miRBase, original name: dgr-mir-3-1 (MI0009120)

Taxonomy by NCBI:
Drosophila grimshawi grimshawi subgroup grimshawi group grimshawi clade picture wing clade Hawaiian Drosophila Drosophila Drosophiliti Drosophilina Drosophilini Drosophilinae Drosophilidae Ephydroidea Acalyptratae Schizophora Cyclorrhapha Eremoneura Muscomorpha Brachycera Diptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TCACTGGGCAAAGTGTGTCTCA

miRNA*
GGATGCATTCTGTACAGTAATG

mismatches: 4
bulges: 0

View larger
pre-miRNA
TGGGATGCATTCTGTACAGTAATGTTGACTCTTGTAAAACCATCACTGGGCAAAGTGTGTCTCAAA

dot-bracket secondary structure
(((((((((((.((..((((.(((...((....)).....))).))))..)).)))))))))))..


SIMILARITIES
miRBase dgr-mir-3-2: 6e-32

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-3: 1e-30

Identical with: dgr-mir-3-2 from miRBase (MNEST036241)

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record

references

[1] Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie, Nature. 450:203-218(2007)., "Evolution of genes and genomes on the Drosophila phylogeny"




Liczniki na strone;