miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST036724
species: Drosophila melanogaster
source: miRBase, original name: dme-mir-4976 (MI0017762)

Taxonomy by NCBI:
Drosophila melanogaster melanogaster subgroup melanogaster group Sophophora Drosophila Drosophiliti Drosophilina Drosophilini Drosophilinae Drosophilidae Ephydroidea Acalyptratae Schizophora Cyclorrhapha Eremoneura Muscomorpha Brachycera Diptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TCCAGGCTGTCGTCCATGGAGT

miRNA*
TCGGTGGATGTCAGCCAGC

mismatches: 2
bulges: 3

View larger
pre-miRNA
GTCGATGCCGGCGTTTCCCGCTCCAGGCTGTCGTCCATGGAGTTTGTGTTGTCAGCATTCAGCTCGGTGGATGTCAGCCAGCGGTGGAAGGCGTCGTCTC
GCT


dot-bracket secondary structure
(.(((((((....((..(((((...(((((.(((((((.(((((.((((.....))))..))))).))))))).))))))))))..)).))))))).)..
...



SIMILARITIES
miRBase dme-mir-4976: 9e-54

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa

references

[1] Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC, Genome Res. 21:203-215(2011)., "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence"




Liczniki na strone;