miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST037562
species: Locusta migratoria
miRNA family: mir-9
source: miRBase, original name: lmi-mir-9a (MI0010645)

Taxonomy by NCBI:
Locusta migratoria Locusta Oedipodinae Acrididae Acridoidea Acridomorpha Caelifera Orthoptera Orthopteroidea Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TCTTTGGTTATCTAGCTGTATGA

miRNA*
ATAAAGCTAGGTTACCGAAGTTA

mismatches: 3
bulges: 0

View larger
pre-miRNA
TCTTTGGTTATCTAGCTGTATGAGTGCATGTGTCTGTCATAAAGCTAGGTTACCGAAGTTA

dot-bracket secondary structure
.(((((((.((((((((.(((((..((....))...))))).)))))))).)))))))...


SIMILARITIES
miRBase oan-mir-9-1: 0.00000000001

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-9: 0.0000000002

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa

references

[1] Wei Y, Chen S, Yang P, Ma Z, Kang L, Genome Biol. 10:R6(2009)., "Characterization and comparative profiling of the small RNA transcriptomes in two phases of locust"




Liczniki na strone;