miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST037641
species: Nasonia vitripennis
miRNA family: mir-14
source: miRBase, original name: nvi-mir-14 (MI0014716)

Taxonomy by NCBI:
Nasonia vitripennis Nasonia Pteromalinae Pteromalidae Chalcidoidea Chaldicoidea group Apocrita Hymenoptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TCAGTCTTTTTCTCTCTCCTA

miRNA*
GGGGTGAGAAACTGGCTTGGCT

mismatches: 3
bulges: 1

View larger
pre-miRNA
CTTTTTATTCGCTCGGTCAGTGGGGGTGAGAAACTGGCTTGGCTATGTACTCCCCATTGTGGACAGTCAGTCTTTTTCTCTCTCCTATTGGCCCGGCGAG
AAT


dot-bracket secondary structure
.......((((((.((((((((((((.((((((..((((.((((.(.(((........))).).))))))))..)))))).)))))))))))).))))))
...



SIMILARITIES
miRBase ngi-mir-14: 2e-42

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-14: 0.000006

Identical with: ngi-mir-14 from miRBase (MNEST037573)

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: 454

references

[1] Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van, Science. 327:343-348(2010)., "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species"




Liczniki na strone;