miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST040655
species: Medicago truncatula
miRNA family: MIR157
source: miRBase, original name: mtr-MIR156h (MI0005613)

Taxonomy by NCBI:
Medicago truncatula Medicago Trifolieae Papilionoideae Fabaceae Fabales fabids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TTGACAGAAGATAGAGAGCAC

miRNA*
GCTCTTTATTCTTCTGTCATCA

mismatches: 1
bulges: 1

View larger
pre-miRNA
TGCTGTTGACAGAAGATAGAGAGCACAGATGATGAAATGCATGGAAGGCAATGGCATCTCATTCCTTTGTGCTCTTTATTCTTCTGTCATCACC

dot-bracket secondary structure
...((.(((((((((((((((((((((((.(((((.((((.((.....))...)))).)))))..))))))))))))).)))))))))).))..


SIMILARITIES
miRBase gma-MIR156e: 6e-33

PMRD mtr-miR156h: 2e-48

microPC miR157: 4e-28
UniProt no hits

RFAM no hits

Identical with: mtr-miR156h from PMRD (MNEST048697)

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: 454, Northern

references

[1] Bonnet E, Unpublished (2007).,
[2] Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R, New Phytol. 184:85-98(2009)., "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families"




Liczniki na strone;