miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST040696
species: Medicago truncatula
miRNA family: MIR171
source: miRBase, original name: mtr-MIR171b (MI0005580)

Taxonomy by NCBI:
Medicago truncatula Medicago Trifolieae Papilionoideae Fabaceae Fabales fabids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TGATTGAGCCGCGTCAATATC

miRNA*
TATTGGCGCGCCTCAATTTGA

mismatches: 2
bulges: 0

View larger
pre-miRNA
AGCAAGGTATTGGCGCGCCTCAATTTGAATACATGGCTATAAAAATGCATCATATCAGCCATGTAGTTTGATTGAGCCGCGTCAATATCTTGTT

dot-bracket secondary structure
(((((((((((((((((.(((((((....((((((((((((...........))).)))))))))....))))))).)))))))))))))))))


SIMILARITIES
miRBase vvi-MIR171b: 0.00000002

PMRD vvi-miR171b: 0.00000002

microPC miR171: 0.00000002
UniProt no hits

RFAM MIR171_1: 3e-47

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: 454, Northern

references

[1] Bonnet E, Unpublished (2007).,
[2] Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R, New Phytol. 184:85-98(2009)., "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families"




Liczniki na strone;